RegulonDB RegulonDB 10.8: Gene Sequence
rutA gene sequence


Size: 1149        A: 257  T: 259  G: 318  C: 315

Fasta

 

>rutA E. coli K12. Version NC_000913.3 GI:556503834
atgcaggatgcagcgccccgtctgactttcactttacgagacgaagagaggttgatgatg
aaaattggcgtattcgtacctattggcaacaacggctggctcatttcgacccacgcgccg
cagtacatgccgacctttgaactgaataaagccattgtgcaaaaagcggagcactaccat
ttcgatttcgccctgtcgatgatcaaactgcgtggctttggcggcaaaactgagttctgg
gatcacaaccttgagtcgttcaccttgatggcggggctggcggccgtgacctcgcgcatt
cagatttacgccactgctgccaccttaacgttacctccggcaatcgtcgcccgtatggcc
gcaaccatcgactccatctctggcgggcgttttggcgtcaacctcgtgactggctggcaa
aagcccgagtatgagcagatgggtatctggcctggcgatgactatttctcccgtcgttac
gactatctcaccgaatatgttcaggtgctgcgcgacctgtggggcacggggaaaagcgat
tttaaaggcgattttttcaccatgaatgattgtcgcgtgagtccgcaaccgagtgtcccc
atgaaagtgatctgcgccgggcaaagcgacgctggcatggcgttctccgcccggtatgcc
gatttcaacttctgtttcggcaaaggcgtaaatacacccacggctttcgccccgaccgct
gcgcggatgaaacaggccgcagagcaaaccggacgcgacgttggctcttatgtgttgttt
atggtgattgccgatgaaaccgacgatgccgctcgcgccaaatgggaacactacaaagcg
ggcgcggatgaagaggcgttaagctggctaaccgaacaaagtcagaaagatacccgctcc
ggtactgacaccaacgttcgtcagatggccgatcccacttcggcggtaaacatcaatatg
gggacgttagtcggttcttacgccagtgtcgcgcgcatgttagatgaagtcgcaagcgtg
cctggtgccgaaggcgtgctgttaaccttcgacgattttctgtcgggaatcgaaaccttc
ggcgagcgcattcaaccactgatgcaatgccgcgcccatctacctgcgctgactcaggag
gtggcatga
              
                            

Download fasta file
RegulonDB