RegulonDB RegulonDB 10.10: Gene Sequence
pgaC gene sequence


Size: 1326        A: 320  T: 387  G: 334  C: 285

Fasta

 

>pgaC E. coli K12. Version NC_000913.3 GI:556503834
atgattaatcgcatcgtatcgttttttatattatgtctggtgttatgcatacccctatgc
gtagcgtactttcactctggtgaactgatgatgaggttcgttttcttctggccgtttttt
atgtccattatgtggattgttggcggcgtctatttctgggtctatcgtgaacgccactgg
ccgtggggagaaaacgcaccagctccccagttgaaagataatccgtctatctccattatc
attccctgttttaatgaggagaaaaacgttgaggaaaccatacacgccgctttagcacag
cgttatgagaacattgaagttattgccgtaaatgacggttcaacagataaaacccgtgcc
atcctggatcgcatggctgcacaaattccccatttgcgggtcattcatctggcgcaaaac
caggggaaagccattgcgcttaaaaccggagctgccgcggcgaaaagtgaatatctggtg
tgcattgatggcgatgcgttattagaccgcgatgcggcggcatatattgtggaaccgatg
ttgtacaacccgcgtgtgggtgccgtaaccggtaatcctcgtattcgaacacgttctacc
ctggtgggtaaaattcaggttggcgagtattcctcaattattggtttgatcaagcgaacc
cagcgtatctatggaaacgtatttaccgtttccggtgttattgccgcatttcgtcgcagc
gccctggcagaagtgggttactggagtgacgatatgatcaccgaagatattgatattagc
tggaagctgcagttgaatcagtggacgattttttacgagccacgggcactgtgctggata
ttaatgcctgaaacgttaaaagggctgtggaaacagcgcctgcgctgggctcagggcggt
gcagaagtattcctcaaaaatatgacaaggttgtggcgcaaagaaaactttcgaatgtgg
ccgctgttttttgaatactgcctgacgacaatatgggccttcacctgcctggtcggtttc
attatttacgcagtccaacttgccggtgtaccgttaaatattgaattgacacatatcgct
gcgacacatactgccggaatattattgtgtacgttatgtttactgcaatttattgtcagc
ctgatgatcgagaatcgctatgagcataatctgacttcatcgcttttctggattatttgg
ttcccggttattttctggatgctgagcctggcaacgacattggtatcatttacacgagtc
atgttgatgcctaaaaagcaacgcgcccgttgggtaagtcccgatcgcgggattctgaga
ggttaa
              
                            

Download fasta file
RegulonDB