RegulonDB RegulonDB 10.10: Gene Sequence
pgaB gene sequence


Size: 2019        A: 586  T: 536  G: 455  C: 442

Fasta

 

>pgaB E. coli K12. Version NC_000913.3 GI:556503834
atgttacgtaatggaaataaatatctcctgatgctggtgagtataattatgctcaccgcg
tgcattagccagtcaagaacatcatttataccgccacaggatcgcgaatctttactcgcc
gagcaaccgtggccgcataatggttttgtagcgatttcatggcataacgttgaagacgaa
gctgccgaccagcgttttatgtcagtgcggacatcagcactgcgtgaacaatttgcctgg
ctgcgcgagaacggttatcaaccggtcagtattgctcaaattcgtgaagcacatcgagga
ggaaaaccgctaccggaaaaagctgtagtgctgacttttgatgacggctaccagagtttt
tatacccgcgtcttcccaattcttcaggccttccagtggcctgctgtatgggcccccgtc
ggcagttgggtcgatacgccagcggataaacaagtaaaatttggcgatgagttggtcgat
cgagaatattttgccacgtggcaacaagtgcgagaagttgcgcgttcccggctcgttgag
ctcgcttctcatacatggaattctcactacggtattcaggctaatgccaccggcagctta
ttgcctgtatatgtaaatcgtgcatattttactgaccacgcacggtatgaaaccgcagca
gaataccgggaaagaattcgtctggatgctgtaaaaatgacggaatacctgcgtacaaag
gttgaggtaaatccacacgtttttgtttggccttatggcgaagcgaatggcatagcgata
gaggaattaaaaaaactcggttatgacatgttcttcacccttgaatcaggtttggcaaat
gcgtcgcaattggattccattccgcgggtattaatcgccaataatccctcattaaaagag
tttgcccagcaaattattaccgtacaggaaaaatcaccacaacggataatgcatatcgat
cttgattacgtttatgacgaaaacctccagcaaatggatcgcaatattgatgtgctaatt
cagcgggtgaaagatatgcaaatatcaaccgtgtatttgcaggcatttgctgatcccgat
ggtgatgggctggtcaaagaggtctggtttccaaatcgtttgctaccaatgaaagcagat
atttttagtcgggttgcctggcaattacgtacccgctcaggtgtaaacatctatgcgtgg
atgccggtattaagctgggatttagatcccacattaacgcgagtaaaatacttaccaaca
ggggagaaaaaagcacaaattcatcctgaacaatatcaccgtctctctcctttcgatgac
agagtcagagcacaagttggcatgttatatgaagatcttgccggacatgctgcttttgat
ggcatattgttccacgatgatgctttgctttcagattatgaagatgccagtgcaccggct
atcacggcttatcagcaagcaggctttagcgggagtctgagcgaaattcgacaaaacccg
gagcaatttaaacagtgggcccgctttaaaagtcgtgcgttaactgacttcactttagaa
cttagtgcgcgcgtaaaagccattcgcggtccacatattaaaactgcacgaaatattttt
gcacttccggtaatacaacctgaaagtgaagcctggtttgcacagaattatgctgatttc
ctaaaaagctatgactggaccgctattatggctatgccttatctggaaggtgtcgcagaa
aaatcggctgaccaatggttaatacaattgaccaatcaaattaaaaacatccctcaggct
aaagacaaatctattttagaattacaggcacaaaactggcagaaaaatggtcagcatcag
gctatttcttcgcaacaactcgctcactggatgagcctattacaactgaatggagtgaaa
aactatggttattatcccgacaattttctgcataaccaacctgaaatagaccttattcgt
cctgagttttcaacagcctggtatccgaaaaatgattaa
              
                            

Download fasta file
RegulonDB