RegulonDB RegulonDB 10.10: Gene Sequence
pgaA gene sequence


Size: 2424        A: 673  T: 604  G: 578  C: 569

Fasta

 

>pgaA E. coli K12. Version NC_000913.3 GI:556503834
atgtattcaagtagcagaaaaaggtgcccgaaaaccaaatgggctttgaaacttcttact
gccgcatttttagcagcgagtcccgcggcgaagagtgctgttaataacgcctatgatgca
ttgattattgaagctcgcaagggtaatactcagccagctttgtcatggtttgcactaaaa
tcagcactcagcaataaccaaattgctgactggttacagattgccttatgggccgggcaa
gataaacaggttattaccgtttacaaccgctaccgtcatcagcaattaccagcgcgtggt
tatgcagctgtcgccgtcgcttatcgtaacctgcaacaatggcaaaactcgcttacactg
tggcaaaaggcgctctctctggagccgcaaaataaggattatcaacggggacaaatttta
accctggcagatgctggtcactatgatactgcgctggttaaacttaagcagcttaactct
ggagcaccggacaaagccaatttactcgcagaagcctatatctataaactggcggggcgt
catcaggatgaattacgggcgatgacagagtcattacctgaaaatgcatctacgcaacaa
tatcccacagaatacgtgcaggcattacgtaataatcaacttgctgccgcgattgacgat
gccaatttaacgccagatattcgcgctgatattcatgccgaactggtcagactgtcgttt
atgcctacgcgcagtgaaagtgaacgttatgccattgccgatcgcgccctcgcccaatac
gctgcattagaaattctgtggcacgataacccagaccgcactgcccagtaccagcgtatt
caggttgatcatcttggcgcgttattaactcgcgatcgttataaagacgttatttctcac
tatcagcgattaaaaaagacggggcaaattattccgccctgggggcaatattgggttgca
tcggcttatctcaaagatcatcagccgaaaaaagcacagtcaataatgaccgagctcttt
tatcacaaggagaccattgccccggatttatccgatgaagaacttgcggatctcttttac
agccacctggagagtgaaaattatccgggcgcgctaactgtcacccaacataccattaat
acttcgccgcctttccttcggttaatgggcacgcctacgagcatcccgaatgatacctgg
ttacaggggcattcgtttctctcaaccgtagcaaaatatagtaatgatcttcctcaggct
gaaatgacagccagagagcttgcttataacgcaccaggaaatcagggactgcgcattgat
tacgcgagtgtgttacaagcccgcggttggcctcgtgcagcagaaaatgaattaaaaaaa
gcagaagtgatcgagccacgtaatattaatctggaggttgaacaagcctggacagcatta
acgttacaagaatggcagcaggcagctgtcttaacgcacgatgttgtcgaacgtgaaccg
caagatcccggcgttgtacgattaaaacgtgcggttgatgtacataatcttgcagagctt
cgtatcgctggctcaacaggaattgatgccgaaggcccggatagtggtaaacatgatgtc
gacttaaccaccatcgtttattcaccaccgctgaaggataactggcgcggttttgctgga
ttcggttatgccgatggacaatttagcgaaggaaaagggattgttcgcgactggcttgcg
ggtgttgagtggcggtcacgtaatatctggctcgaggcagagtacgctgaacgcgttttc
aatcatgagcataaacccggcgcgcgcctgtctggctggtatgattttaatgataactgg
cgtattggttcgcaactggaacgcctctctcaccgcgttccattacgggcaatgaaaaat
ggtgttacaggcaacagtgctcaggcttatgttcgctggtatcaaaatgagcggcgtaag
tacggtgtctcctgggctttcactgatttttccgacagtaaccagcgtcatgaagtctca
cttgagggtcaggaacgcatctggtcttcaccatatttgattgtcgatttcctacccagt
ctgtattacgaacaaaatacagaacacgataccccatactacaaccctataaaaacgttc
gatattgttccggcatttgaggcaagccatttgttatggcgaagctatgaaaatagctgg
gagcaaatattcagcgcaggtgttggtgcctcctggcaaaaacattatggcacggatgtc
gtcacccaactcggctacgggcaacgcattagttggaatgacgtgattgatgctggcgca
acgctacgctgggaaaaacgaccttatgacggtgacagagaacacaacttatacgttgaa
ttcgatatgacattcagattttaa
              
                            

Download fasta file
RegulonDB