RegulonDB RegulonDB 10.9: Gene Sequence
insF4 gene sequence


Size: 867        A: 203  T: 186  G: 260  C: 218

Fasta

 

>insF-4 E. coli K12. Version NC_000913.3 GI:556503834
atgaagtatgtctttattgaaaaacatcaggctgagttcagcatcaaagcaatgtgccgc
gtgctccgggtggcccgcagcggctggtatacgtggtgtcagcggcggacaaggataagc
acgcgtcagcagttccgccaacactgcgacagcgttgtcctcgcggcttttacccggtca
aaacagcgttacggtgccccacgcctgacggatgaactgcgtgctcagggttaccccttt
aacgtaaaaaccgtggcggcaagcctgcgccgtcagggactgagggcaaaggcctcccgg
aagttcagcccggtcagctaccgcgcacacggcctgcctgtgtcagaaaatctgttggag
caggatttttacgccagtggcccgaaccagaagtgggcaggagacatcacgtacttacgt
acagatgaaggctggctgtatctggcagtggtcattgacctgtggtcacgtgccgttatt
ggctggtcaatgtcgccacgcatgacggcgcaactggcctgcgatgccctgcagatggcg
ctgtggcggcgtaagaggccccggaacgttatcgttcacacggaccgtggaggccagtac
tgttcagcagattatcaggcgcaactgaagcggcataatctgcgtggaagtatgagcgca
aaaggttgctgctacgataatgcctgcgtggaaagcttctttcattcgctgaaagtggaa
tgtatccatggagaacactttatcagccgggaaataatgcgggcaacggtgtttaattat
atcgaatgtgattacaatcggtggcggcggcacagttggtgtggcggcctcagtccggaa
caatttgaaaacaagaacctcgcttag
              
                            

Download fasta file
RegulonDB