RegulonDB RegulonDB 10.9: Gene Sequence
insE4 gene sequence


Size: 300        A: 94  T: 56  G: 69  C: 81

Fasta

 

>insE-4 E. coli K12. Version NC_000913.3 GI:556503834
atgacaaaaacagtatcaaccagtaaaaaaccccgtaaacagcattcgcctgaatttcgc
agtgaagccctgaagcttgctgaacgcatcggtgttactgccgcagcccgtgaactcagc
ctgtatgaatcacaactctacaactggcgcagtaaacagcaaaatcagcagacgtcttct
gaacgtgaactggagatgtctaccgagattgcacgtctcaaacgccagctggcagaacgg
gatgaagagctggctatcctccaaaaggccgcgacatacttcgcgaagcgcctgaaatga
              
                            

Download fasta file
RegulonDB