RegulonDB RegulonDB 10.9: Gene Sequence
ymdE gene sequence


Size: 303        A: 92  T: 86  G: 65  C: 60

Fasta

 

>ymdE E. coli K12. Version NC_000913.3 GI:556503834
atgcgcgattatcttgccggactggatatcgcttcgccagagcatcaggttctgatgaac
gtaacagcaaaaagcgaggtcgctccgtcaattatcaaagaaaatctctcattacactta
actcatacggtgaaatggactgaatctctcgatacatttctgaatatgccaaccccggta
gctttccttgaaataagtaataagccctatttggggaatatgttaaatgattttgctggc
gtggatcagcaacgagttatgcattgtcgtaaagcatttagtgatgcaaaggtattcaaa
tga
              
                            

Download fasta file
RegulonDB