RegulonDB RegulonDB 10.9: Gene Sequence
ycdU gene sequence


Size: 987        A: 219  T: 368  G: 228  C: 172

Fasta

 

>ycdU E. coli K12. Version NC_000913.3 GI:556503834
atgattcctgattatttaacttttattcgctttcaggataaacgaaatctgatatacatt
tatgctattggacttattctgataggcttttattggaagaatgcagggtttacttttcca
tcagaggatattggtgtagttagtgggattctggctctggtgctgtataattttattttt
gatctcaaggcgtactgggcttataaatgcgtcacgaagaatatcgatttttcgtggttt
aagaaaaagcagaaccacaaaatagaattatttcttacacaacctctggtggcaggattt
ctgtcgttaatcatgttgagtgcaatgagttgggggctataccagcttctaccctcgtta
tatgcgctgttcctgatttcgttacttgggccgttggtcatctttctgctgtttcggatg
atccgcaccagttatgtcaagcaggtcgctatttcagtagcgaaaaaagtaaaatataaa
agtctgactcgctatgtgctgctttcggtgtgcatctcaacggttgttaacctgcttact
atcagcccgttgcgtaacagtgattcttttgtgacagaggggcagtggttaacgtttaaa
tcgataattgcattgctcattctttgtggcgtagtgttggcgattaatctgttttttctg
cgcttctccaagcggtacgcttttctgggcaggctttttttgcaggaaatcgatctgttt
ttctccagtgaaaatgcgttgtcgaccttttttgccaagccgctttggcttcggttattc
atattgctggttattgaagtgatgtggattacgctggtgtcggtattggcaacgcttgta
gaatggcggatttggtttgaagcctattttttactctgctatgtaccgtgcttaatttac
tattttttctattgtcgattcctctggcataacgattttatgatggcatgtgacatgtat
ttccgttgggggcattttaataagtga
              
                            

Download fasta file
RegulonDB