RegulonDB RegulonDB 10.9: Gene Sequence
ghrA gene sequence


Size: 939        A: 221  T: 237  G: 250  C: 231

Fasta

 

>ghrA E. coli K12. Version NC_000913.3 GI:556503834
atggatatcatcttttatcacccaacgttcgatacccaatggtggattgaggcactgcgc
aaagctattcctcaggcaagagtcagagcatggaaaagcggagataatgactctgctgat
tatgctttagtctggcatcctcctgttgaaatgctggcagggcgcgatcttaaagcggtg
ttcgcactcggggccggtgttgattctattttgagcaagctacaggcacaccctgaaatg
ctgaacccttctgttccactttttcgcctggaagataccggtatgggcgagcaaatgcag
gaatatgctgtcagtcaggtgctgcattggtttcgacgttttgacgattatcgcatccag
caaaatagttcgcattggcaaccgctgcctgaatatcatcgggaagattttaccatcggc
attttgggcgcaggcgtactgggcagtaaagttgctcagagtctgcaaacctggcgcttt
ccgctgcgttgctggagtcgaacccgtaaatcgtggcctggcgtgcaaagctttgccgga
cgggaagaactgtctgcatttctgagccaatgtcgggtattgattaatttgttaccgaat
acccctgaaaccgtcggcattattaatcaacaattactcgaaaaattaccggatggcgcg
tatctcctcaacctggcgcgtggtgttcatgttgtggaagatgacctgctcgcggcgctg
gatagcggcaaagttaaaggcgcaatgttggatgtttttaatcgtgaacccttaccgcct
gaaagtccgctctggcaacatccacgcgtgacgataacaccacatgtcgccgcgattacc
cgtcccgctgaagctgtggagtacatttctcgcaccattgcccagctcgaaaaaggggag
agggtctgcgggcaagtcgaccgcgcacgcggctactaa
              
                            

Download fasta file
RegulonDB