RegulonDB RegulonDB 11.0: Gene Sequence
ycdY gene sequence


Size: 555        A: 124  T: 134  G: 163  C: 134

Fasta

 

>ycdY E. coli K12. Version NC_000913.3 GI:556503834
atgaacgagttttctatcctctgtcgtgtgctgggttcgctctattaccgccaaccacaa
gatcctttactggtgccgctgtttaccctgattcgtgaggggaaactggctgcgaactgg
ccactggagcaggatgagttgctgacacgtttgcagaaaagctgtgatatgacgcaagtc
tctgccgattacaatgcgttgtttatcggcgatgaatgtgctgtgccgccatatcgtagc
gcatgggttgagggcgcgacggaagcggaagtgcgcgcttttctttctgagcgagggatg
ccattagcggatacgccagccgatcacatcggcacattgctgctcgcagcttcctggctg
gaagatcagtcaacggaagatgagagcgaagcactggaaacactgttcagtgagtatctg
ttaccctggtgtggtgcgttccttggcaaagtggaggcccatgcaaccacgcctttctgg
cgcaccatggcaccgctaacccgcgatgccattagtgcaatgtgggacgagctggaagaa
gattctgaagaataa
              
                            

Download fasta file
RegulonDB