RegulonDB RegulonDB 10.9: Gene Sequence
csgG gene sequence


Size: 834        A: 210  T: 206  G: 211  C: 207

Fasta

 

>csgG E. coli K12. Version NC_000913.3 GI:556503834
atgcagcgcttatttcttttggttgccgtcatgttactgagcggatgcttaaccgccccg
cctaaagaagccgccagaccgacattaatgcctcgtgctcagagctacaaagatttgacc
catctgccagcgccgacgggtaaaatctttgtttcggtatacaacattcaggacgaaacc
gggcaatttaaaccctacccggcaagtaacttctccactgctgttccgcaaagcgccacg
gcaatgctggtcacggcactgaaagattctcgctggtttataccgctggagcgccagggc
ttacaaaacctgcttaacgagcgcaagattattcgtgcggcacaagaaaacggcacggtt
gccattaataaccgaatcccgctgcaatctttaacggcggcaaatatcatggttgaaggt
tcgattatcggttatgaaagcaacgtcaaatctggcggggttggggcaagatattttggc
atcggtgccgacacgcaataccagctcgatcagattgccgtgaacctgcgcgtcgtcaat
gtgagtaccggcgagatcctttcttcggtgaacaccagtaagacgatactttcctatgaa
gttcaggccggggttttccgctttattgactaccagcgcttgcttgaaggggaagtgggt
tacacctcgaacgaacctgttatgctgtgcctgatgtcggctatcgaaacaggggtcatt
ttcctgattaatgatggtatcgaccgtggtctgtgggatttgcaaaataaagcagaacgg
cagaatgacattctggtgaaataccgccatatgtcggttccaccggaatcctga
              
                            

Download fasta file
RegulonDB