RegulonDB RegulonDB 10.9: Gene Sequence
csgD gene sequence


Size: 651        A: 200  T: 179  G: 131  C: 141

Fasta

 

>csgD E. coli K12. Version NC_000913.3 GI:556503834
atgtttaatgaagtccatagtattcatggtcatacattattgttgatcactaaatcttct
ttgcaggcgacagctctcttgcagcaccttaaacaatcgctggcaattacaggaaaatta
cataatattcaacgttctctggacgatatctcttcaggctctattattcttctggatatg
atggaagcggataaaaagcttatccattattggcaggatactttgagcaggaaaaacaac
aatatcaaaatattgttgctaaatacgcctgaagattacccgtaccgcgacattgaaaac
tggcctcatatcaacggcgttttttattccatggaggatcaagaacgtgttgtcaatggg
ttgcaaggcgtcctgcgcggcgaatgctactttacgcaaaagcttgccagctacctgatt
acgcattcaggtaactatcgttataacagcacggaatcagccctccttactcatcgggaa
aaagagatcctgaataagctgcgtatcggcgcgtctaataacgagatcgctcgttcgttg
ttcatcagcgaaaatacggttaaaacgcatctttataatcttttcaagaagatagccgta
aaaaaccggacacaagcggtttcctgggcaaacgataacctcaggcgataa
              
                            

Download fasta file
RegulonDB