RegulonDB RegulonDB 10.9: Gene Sequence
ymdB gene sequence


Size: 534        A: 129  T: 129  G: 146  C: 130

Fasta

 

>ymdB E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacgcgtattcatgttgtgcagggtgatattaccaaactggccgttgatgtgatt
gtgaatgcggctaatccgtcattaatgggaggcggcggcgtcgatggggccattcatcgc
gcagcgggtccggccctgctggatgcttgtttaaaagtcaggcaacagcagggcgattgc
cctacggggcatgccgttattacgcttgcaggcgatcttcccgctaaagccgtagtgcac
accgtcgggccagtctggcgtggtggtgaacaaaacgaagaccagcttttgcaggatgcc
tatctcaatagcctacgactggtggcggcaaacagctatacgtcagtggcttttcctgca
atcagtactggggtttatggttaccctcgtgcggcagcggctgaaatcgcagtaaaaacc
gtttcagaatttattacccgtcacgctttacccgaacaggtatactttgtctgttatgat
gaagaaaacgcccacctctacgaaagactccttacccaacaaggagatgaatga
              
                            

Download fasta file
RegulonDB