RegulonDB RegulonDB 10.8: Gene Sequence
clsC gene sequence


Size: 1422        A: 326  T: 375  G: 382  C: 339

Fasta

 

>clsC E. coli K12. Version NC_000913.3 GI:556503834
ttgccccggctggcgagcgcggtgctgccactgtgttcgcaacatcccggtcagtgtggc
ctttttcctctggagaaaagtctggatgcgtttgccgcccggtatcgtctggccgaaatg
gcagagcatacgctcgatgttcagtattacatctggcaggacgatatgtcgggtcggtta
ctgttttccgccctgttagccgcagcaaagcgtggcgttcgcgtccgtttgttgctggac
gacaacaatacgcccggacttgacgacattttacgcttgcttgacagtcatccacgcatt
gaagtccggctttttaatcctttctcgtttcgcttgctgcgtccgcttggttatatcacc
gacttttcccgtcttaatcgccgtatgcacaataaaagtttcactgtcgatggcgtggtg
accctggtgggaggacgaaatattggtgatgcctattttggagcaggggaggagccactt
ttttcggatttagatgtcatggcaataggacccgtggtagaggacgttgccgatgatttc
gcccgctactggtattgcaaatcggtttcacccttacagcaggtgctggatgtcccggag
ggtgaaatggcggatcgcatcgagttacccgcctcctggcataacgatgccatgacgcat
cgttatttacgcaaaatggaatccagtccatttataaatcatctggttgatggaacattg
ccgcttatctgggcgaagacacgtttattaagtgatgatccggcgaaaggggagggcaag
gcaaaacggcattcactgttaccgcagcgcctgttcgatatcatgggctcacccagtgaa
cgcatcgatattatctcttcctattttgtaccgacacgcgcaggtgtggcgcaactctta
cggatggtgagaaaaggggtaaagattgcgatcctaaccaattctcttgccgctaacgat
gttgctgtcgtccatgccggatacgcgcgctggcgcaaaaaattgctccgctatggcgtg
gaattatatgaactcaagccgacgcgtgaacaaagtagtacgttacacgatcgcggcata
accggtaattccggagccagcctgcatgctaaaacctttagcatcgatggtaaaacggtg
tttatcggctctttcaatttcgatccgcgttcaacattgctcaatactgaaatgggcttc
gtgatagagagcgaaacgctggcacagttaattgataaacgctttattcagagccagtat
gatgcggcctggcagctccgtctggacaggtggggacggatcaactgggttgatcgtcat
gcaaagaaagagattattctcaaaaaagaacccgccaccagtttctggaagcgggttatg
gtcagactggcgtcgatattgcccgtggaatggttattgtaa
              
                            

Download fasta file
RegulonDB