RegulonDB RegulonDB 10.9: Gene Sequence
opgC gene sequence


Size: 1158        A: 267  T: 383  G: 248  C: 260

Fasta

 

>opgC E. coli K12. Version NC_000913.3 GI:556503834
atgaacccagtacccgcgcaacgtgaatatttcctcgactccatccgcgcctggctgatg
ttgttagggataccttttcatatttctttaatctattcgagccatacatggcatgtgaat
agcgccgaatcatcattgtggctgaccctttttaatgacttcatccactcgttccgcatg
caggtatttttcgttatatccggctacttttcctacatgctttttttacgctatcccttg
aaaaaatggtggaaagtacgtgtcgaacgtgtaggtatcccgatgttaacagccatcccc
ctactgacattaccgcaatttattatgctgcaatatgtcaaaggaaaagcggaaagttgg
cctgggctgtcattgtatgacaaatataatacgttggcctgggaattaatatcacacctg
tggtttttactggtgttagtggtcatgacgacgctgtgcgtatggatatttaagcgcatc
agaaataatttagaaaattctgataaaacgaataaaaaattctcgatggtaaaactatcg
gtgatttttttatgcctcggcatcggttatgcggtaataagaagaacgatttttattgtg
tatccgcccattctgagtaatggcatgttcaattttattgtcatgcaaacgctgttttat
ttgccgttctttatcctcggcgcactggctttcattttccctcatcttaaagccttgttt
accacgccgtctcgtggctgtacccttgcagcagcattggcgtttgtcgcttatttactc
aaccagcgctatggcagtggcgatgcctggatgtacgaaaccgagtcggtgatcaccatg
gtcctcggtctgtggatggtgaatgtggtcttctcctttggccaccgtttgcttaacttc
cagtcagcgcgggtgacttattttgttaacgcatcgctgtttatctatctggttcaccac
ccgttaacgctgtttttcggcgcatacattacaccgcacatcacctccaactggcttggt
tttctctgtggcctgatatttgtagtagggattgcgataattctgtatgaaattcatttg
cgcatcccgttactgaagtttttgttctctggtaaaccggttgttaagcgtgagaacgat
aaagcaccagcccgttaa
              
                            

Download fasta file
RegulonDB