RegulonDB RegulonDB 11.0: Gene Sequence
b1052 gene sequence


Size: 99        A: 25  T: 29  G: 19  C: 26

Fasta

 

>b1052 E. coli K12. Version NC_000913.3 GI:556503834
atggaacagtctacgtcgtcgtcgaataccccaggtatcgaactgatttttcgcctttca
tacttgcaaaagcggagaatcagctatccttttccctga
              
                            

Download fasta file
RegulonDB