RegulonDB RegulonDB 10.9: Gene Sequence
yceO gene sequence


Size: 141        A: 29  T: 59  G: 31  C: 22

Fasta

 

>yceO E. coli K12. Version NC_000913.3 GI:556503834
atgaggccgtttttacaggagtatttaatgcgtcggctgttgcactatctcatcaataat
attcgcgagcatctgatgctttatctttttctctggggattgttggcaattatggatctg
atctatgtgttttatttttag
              
                            

Download fasta file
RegulonDB