RegulonDB RegulonDB 10.9: Gene Sequence
dinI gene sequence


Size: 246        A: 68  T: 60  G: 63  C: 55

Fasta

 

>dinI E. coli K12. Version NC_000913.3 GI:556503834
atgcgaattgaagtcaccatagcgaaaacttctccattgccagctggggctattgacgcc
ctggctggcgaactttcccgccgtattcagtatgcgtttcctgataatgaaggccacgta
tcggtacgttatgccgcagcgaataatttatcggttattggcgcgacaaaagaagataaa
cagcgcattagtgaaattctccaggaaacgtgggaaagcgccgatgactggtttgtcagc
gaataa
              
                            

Download fasta file
RegulonDB