RegulonDB RegulonDB 10.9: Gene Sequence
mdtH gene sequence


Size: 1209        A: 199  T: 341  G: 365  C: 304

Fasta

 

>mdtH E. coli K12. Version NC_000913.3 GI:556503834
atgtcccgcgtgtcgcaggcgaggaacctgggtaaatatttcctgctcatcgataatatg
ctggtcgtgctggggttctttgttgtcttcccgctgatctctatccgcttcgttgatcaa
atgggctgggccgccgtcatggtcggtattgctctcggtctacgccaatttattcagcaa
ggtctgggtattttcggcggtgcaattgccgaccgctttggtgccaaaccgatgattgtt
accggtatgctgatgcgcgccgccggattcgccacaatgggtatcgcccacgaaccgtgg
ctattgtggttttcatgcctgctctcgggactcggtggcacgttgtttgatccgccgcgt
tcggcgctggtggtgaaattaatccgtccacagcagcgtggtcgttttttctcgctgttg
atgatgcaggacagtgccggtgcggtcattggcgcattgttggggagctggctgttgcaa
tacgactttcgcctggtctgcgccacaggggcagttctatttgtgctatgtgcggcgttc
aatgcgtggttgttaccagcatggaaactctccaccgtacgcacgcccgttcgcgaaggc
atgacccgcgtgatgcgtgacaagcgttttgtcacctatgttctgacgctggcgggttac
tacatgctggctgtacaagtgatgctgatgctgccaattatggtcaacgacgtggctggc
gcgccctctgccgttaaatggatgtatgccattgaagcgtgtctgtcgttaacgttgctc
taccctatcgcccgctggagtgaaaagcattttcgtctggaacaccggttgatggctggg
ctgttgataatgtcattaagcatgatgccggtgggcatggtcagcggcctgcaacaactt
ttcaccctgatttgtctgttttatatcgggtcgatcattgccgagcctgcgcgtgaaacc
ttaagtgcttcgctggcggacgcaagagctcgcggcagctatatggggtttagccgtctg
ggtctggcgattggcggcgctattggttatatcggtggcggctggctgtttgacctgggc
aaatcggcgcaccagccagagcttccgtggatgatgctgggcattattggcatcttcact
ttccttgcgctgggttggcagtttagccagaaacgcgccgcgcgtcgtttgcttgaacgc
gacgcctga
              
                            

Download fasta file
RegulonDB