RegulonDB RegulonDB 10.9: Gene Sequence
yceM gene sequence


Size: 924        A: 200  T: 213  G: 281  C: 230

Fasta

 

>yceM E. coli K12. Version NC_000913.3 GI:556503834
gtgaaaaaattacgtatcggcgtagtgggattaggtggcattgcgcaaaaagcgtggtta
ccggtgctggcggcagcgtctgactggacgttacaaggagcctggtcgcctacgcgcgcg
aaagccctgccaatttgtgaaagctggcgcattccttatgccgattcgttatccagcctt
gccgccagttgcgatgcggtttttgtgcattccagcaccgccagccactttgacgtggtc
agtacgttactcaatgcgggggtacatgtctgtgtcgataaaccgctggcagaaaatctg
cgcgatgctgaacggctggtggaactggcggcgcggaaaaaactgacgttgatggtcggt
tttaaccgtcgtttcgcaccactctacggtgagttaaaaacgcaactcgccaccgcagcc
tcgctaagaatggataaacatcgtagcaatagcgtcgggccacacgatctttatttcacg
ttgctggatgattatctgcatgtggtggataccgcgctgtggttgtcgggcggcaaagcc
tctctggatggcggtacgctactgactaacgacgctggcgaaatgctgtttgccgagcac
catttttcggctggtcctttgcagatcaccacctgtatgcatcgccgtgccggaagtcag
cgtgaaaccgtgcaggccgtgactgacggtgcgctcatcgacattacggatatgcgcgaa
tggcgtgaggagcgcgggcagggcgtagtgcataaaccgattcctggttggcagagtacg
cttgagcaacgtgggtttgtcggctgtgcgcggcacttcattgaatgtgtgcaaaaccag
acagttccgcaaaccgccggcgaacaggccgtgctggcgcaacgtatcgttgacaagatc
tggcgcgatgcgatgagtgaataa
              
                            

Download fasta file
RegulonDB