RegulonDB RegulonDB 10.9: Gene Sequence
flgN gene sequence


Size: 417        A: 138  T: 78  G: 102  C: 99

Fasta

 

>flgN E. coli K12. Version NC_000913.3 GI:556503834
atgacacgtcttgcagagatcctcgaccagatgtccgctgtgcttaacgatctcaaaacg
gtaatggatcaagagcagcaacatctctctatggggcagatcaacggcagccagttgcaa
tggattacagaacaaaaaagctcactgctggcgacgctggattacctcgaacagttacgc
aggaaagaacccaatacagcaaatagcgttgatattagtcaacgctggcaggaaattact
gtgaaaacgcagcaactacgccaaatgaatcaacataacggctggttactggaaggacag
attgagcgcaatcaacaggcgctggaaatgttgaaaccgcatcaggaaccgacgctatat
ggggcgaacggtcagacctcaacaacccatcgcggcggtaaaaagatttcgatctga
              
                            

Download fasta file
RegulonDB