RegulonDB RegulonDB 10.9: Gene Sequence
yceQ gene sequence


Size: 321        A: 85  T: 93  G: 66  C: 77

Fasta

 

>yceQ E. coli K12. Version NC_000913.3 GI:556503834
gtgtcggttgcccgtttttcatgcggaaaaacagcgcaattatcaaagaaacagactggg
tattactctccagaaatatttccatctaccggtaaggactgcaacccgcagcccgctaac
tgcctgaaagatcaatacgtcttacgccattgctgcgtggatgatcggtcgggcaaaatg
ggttattccgtaaaatttcttgttttaacaaggatggacacggaaacggcctcattattc
cactgcaagccttgttatagcaagatgacttttaccatttatcacccgcttactcacagt
tttttcacttcttgctggtga
              
                            

Download fasta file
RegulonDB