RegulonDB RegulonDB 10.9: Gene Sequence
ycfL gene sequence


Size: 378        A: 86  T: 105  G: 99  C: 88

Fasta

 

>ycfL E. coli K12. Version NC_000913.3 GI:556503834
atgagaaaaggatgctttgggctggtgtctctggtgttgttactgctggtgggctgtcgt
tcacatccggaaattccggtgaatgatgagcaatcgctggtgatggagtcatctttattg
gctgcgggcatcagtgcagaaaagcccttcctttcgacgtctgatattcaaccttcagca
tcctcaacgctttataacgaaaggcaagaacccgttaccgttcattatcgtttttactgg
tatgacgccagagggctggagatgcatcctctggaaaggccacgcagcgttaccattccc
gcacattcggcggtaacgctgtacggcagcgccaattttctgggggcgcacaaagtcaga
ctttatctatatttgtaa
              
                            

Download fasta file
RegulonDB