RegulonDB RegulonDB 10.9: Gene Sequence
lpoB gene sequence


Size: 642        A: 155  T: 125  G: 183  C: 179

Fasta

 

>lpoB E. coli K12. Version NC_000913.3 GI:556503834
atgacaaaaatgagtcgctacgccttgattaccgcgctggcgatgtttctcgccgggtgt
gtggggcaacgtgaacctgcaccggtagaagaagtgaaaccagcgccggaacaaccagcc
gagccacaacagcctgtccccacagtgccctcggtgccgacgatcccgcagcagccaggc
ccaattgagcacgaagatcaaactgcaccgcctgcgccgcatattcgccattatgactgg
aatggcgcaatgcagccgatggtcagtaagatgcttggggctgacggggtgactgcgggt
agcgtcctgctggttgatagcgttaacaaccgtactaacggttcgctgaatgccgcagaa
gcgaccgaaacgctgcgaaatgcgctggctaataacgggaaatttaccctggtttccgcc
cagcaactgtcgatggcgaagcaacagttaggtttgtcgccgcaggacagtttaggcacc
cgtagtaaagccataggcattgcccgcaatgtcggcgctcattacgtgctgtactccagc
gcctctggcaacgttaacgctccgaccctacaaatgcagctgatgctggtgcagacgggc
gaaattatctggtcaggtaaaggtgccgtttcgcagcaataa
              
                            

Download fasta file
RegulonDB