RegulonDB RegulonDB 10.9: Gene Sequence
thiK gene sequence


Size: 825        A: 188  T: 197  G: 231  C: 209

Fasta

 

>thiK E. coli K12. Version NC_000913.3 GI:556503834
gtgccgtttcgcagcaataatcccatcacgcgcgacgaattgctgtcgcgctttttcccg
cagtatcatcccgtcacgacgtttaatagtgggcttagtggcgggagttttctcattgaa
catcagggccagcgttttgttgtgcgtcagccgcacgatcctgatgcgccgcagtccgcg
ttcttgcgccagtatcgggctttatcacaactacccgcatgcattgcaccgaagccgcat
ttatatctccgtgactggatggtagtcgactatctgcccggcgcggtaaaaacgtatttg
ccggataccaacgaactggcaggcttgctgtattatctacatcaacaaccacgttttggc
tggcgaataacgctgttgccgttactggaactgtactggcagcaaagcgatccggcgcgg
cggacagtgggttggctgcgaatgttaaaacgtctgcgcaaagcgcgggaaccacggcct
ttacgcttaagtccattgcatatggatgtccacgccggaaatttagtgcatagcgcgtca
gggttaaaactcatcgactgggagtatgccggagatggtgatatcgcgctggaactggcg
gcggtgtgggtggaaaatactgaacagcaccggcaattggtcaatgactatgccactcgc
gcgaagatttatccggcgcaattatggcgtcaggtcaggcgatggtttccctggctgctg
atgctcaaagcagggtggtttgagtaccgctggcgacaaaccggcgatcaacaatttatc
aggctggccgatgacacctggcggcagctattaataaaacaataa
              
                            

Download fasta file
RegulonDB