RegulonDB RegulonDB 10.9: Gene Sequence
nagZ gene sequence


Size: 1026        A: 241  T: 241  G: 307  C: 237

Fasta

 

>nagZ E. coli K12. Version NC_000913.3 GI:556503834
gtgggtccagtaatgttggatgtcgaaggttacgaactggacgcggaagagcgtgaaata
ctggcgcatccgctggtgggagggctgattctctttacgcgtaactatcatgatcctgcc
cagttacgtgaactggtgcgccagatccgcgcagcttcgcgcaatcgtctggtggtggcg
gttgatcaggaaggtggacgcgtgcagcgttttcgtgaaggttttacccgcttgccagcg
gcgcaatcattcgctgcgctgtcaggaatggaagagggtggcaaactggcgcaggaggca
ggttggttgatggccagcgaaatgatcgctatggatattgatatcagctttgcgcctgtg
ctggatgtcgggcatatcagcgcggcgattggcgagcgttcttatcatgccgatccacaa
aaagccctggcaattgccagccggtttattgatggtatgcatgaagccggaatgaaaacg
accgggaaacacttcccaggacacggtgcagtaacggcagactcacacaaagaaacaccg
tgcgatccacgtccacaagcggagattcgcgctaaagatatgtcggtcttcagttcctta
atccgcgaaaataaactcgacgccattatgcctgcgcatgtgatctacagtgatgttgat
ccgcgtccggcgagcggttctccctactggctgaaaaccgttttgcgtcaggaactgggt
tttgacggcgtgattttctctgacgatttatcgatggaaggtgccgcgattatgggcagt
tatgccgaacgcgggcaggcttcactggatgcgggttgcgatatgatcctggtctgcaat
aatcgtaaaggggccgtcagcgtgttagataatctgtcaccgatcaaggcagaacgtgtt
acacgtttgtatcataaaggttcattttcgcgacaggaactgatggactcggctcgctgg
aaagcgatcagcacccgtctgaatcagttacatgaacgctggcaggaagagaaagcaggt
cactaa
              
                            

Download fasta file
RegulonDB