RegulonDB RegulonDB 10.9: Gene Sequence
ycfP gene sequence


Size: 543        A: 149  T: 141  G: 135  C: 118

Fasta

 

>ycfP E. coli K12. Version NC_000913.3 GI:556503834
atgattatctatttacacggttttgactctaacagtccgggtaaccacgagaaagtctta
caattgcagtttattgacccggatgtacgcttgataagctacagtacgcggcatccgaaa
catgatatgcagcatctgcttaaagaagtggacaaaatgttgcaactgaacgttgacgag
cgtccgctaatttgcggcgttggcttgggcggatactgggcggaacggattggttttctt
tgcgacatccgccaggtgatcttcaaccctaatttgttcccttatgagaacatggaaggc
aagattgatcgcccggaagagtatgccgatattgccactaagtgtgtgaccaacttccgt
gagaagaatcgcgatcgttgcctggtgattttgtcgcgtaatgatgaagcgcttaacagc
cagcggacatctgaagagttgcatcattattacgagattgtctgggacgaagagcagacg
cacaaattcaagaatatctccccgcatttacagcgcattaaagcgttcaaaaccctcggg
taa
              
                            

Download fasta file
RegulonDB