RegulonDB RegulonDB 10.9: Gene Sequence
comR gene sequence


Size: 633        A: 168  T: 141  G: 159  C: 165

Fasta

 

>comR E. coli K12. Version NC_000913.3 GI:556503834
atggcaactgactcaacacaatgtgtaaaaaaaagccgtggccgcccaaaagtgttcgac
agggatgccgcgcttgataaggccatgaaattgttctggcaacacggttatgaagcgact
tctcttgcggacctcgtcgaagcgaccggagccaaagcgcccacgctatacgcggaattt
accaacaaagaggggttatttcgtgccgttctcgaccgctatatcgatcgttttgccgct
aagcatgaagcacagctgttttgtgaagagaaaagcgtggagtctgcgctggctgactat
tttgctgccatcgccaactgctttaccagcaaagacaccccggcaggctgcttcatgatc
aacaactgcaccaccctctccccagattcaggagatatcgccaatacgttgaaatcacgc
catgcgatgcaagagcgcactttgcagcagtttttatgtcaacgacaagcgcgcggggaa
atcccgccccactgtgacgtgacacatctggcagaattccttaattgtattattcagggg
atgtcgatcagcgcacgcgaaggtgcatcgctggaaaaactgatgcagattgccggaacg
actttgcgtttatggcccgaactggtgaaataa
              
                            

Download fasta file
RegulonDB