RegulonDB RegulonDB 10.9: Gene Sequence
bhsA gene sequence


Size: 258        A: 80  T: 56  G: 62  C: 60

Fasta

 

>bhsA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaacgtaaaaaccctcatcgctgcggcgattttaagctccatgtcatttgccagc
tttgcggctgtcgaagttcagtcaacgccagaaggccaacaaaaagtcggtacaatcagt
gctaacgcggggacaaatctgggatcgctggaagagcagctggcgcaaaaagcggatgag
atgggcgcaaaatctttccgtattacttctgtaaccggtccgaataccctccatggaaca
gcagtaatttataaataa
              
                            

Download fasta file
RegulonDB