RegulonDB RegulonDB 10.9: Gene Sequence
ldtC gene sequence


Size: 963        A: 232  T: 218  G: 256  C: 257

Fasta

 

>ldtC E. coli K12. Version NC_000913.3 GI:556503834
gtgatgatcaaaacgcgtttttctcgctggctaacgttttttacgttcgccgctgccgtg
gcgctggcgctaccggcaaaagccaacacctggccgctgccgccagcgggcagtcgtctg
gttggcgaaaacaaatttcatgtggtggaaaatgacggtggttctctggaagccatcgcc
aaaaaatacaacgtcggctttctcgctctgttacaggctaaccccggcgttgatccttac
gtaccgcgcgcgggcagcgtgttaacgatcccgttgcaaaccctacttccagatgcgccg
cgcgaaggcattgtgatcaacattgcggagctgcgtctctattactacccgccgggtaaa
aattcggtaaccgtgtatccaataggtattggtcagttaggtggtgacacgctgacaccg
acaatggtgaccaccgtttcagacaaacgtgcaaacccaacctggacgccaacggcaaac
atccgcgcccgttataaagcacagggaattgagttgcctgcggtagtgccggctggactg
gataacccaatgggccatcatgcgattcgtctggcggcctatggcggcgtttatttgctt
catggtacgaacgccgatttcggcattggcatgcgggtaagttctggctgtattcgtctg
cgggatgacgatatcaaaacactctttagccaggtcaccccaggcaccaaagtgaatatc
atcaacactccgataaaagtctctgccgaaccaaacggtgcgcgtctggttgaagtacat
cagccgctgtcagagaagattgatgacgatccgcagctgctgccaattacgctgaatagc
gcaatgcaatcatttaaagatgcagcacaaactgacgctgaagtgatgcaacatgtgatg
gatgtccgttccgggatgccggtggatgtccgccgtcatcaagtgagcccacaaacgctg
taa
              
                            

Download fasta file
RegulonDB