RegulonDB RegulonDB 10.8: Gene Sequence
lolC gene sequence


Size: 1200        A: 260  T: 290  G: 339  C: 311

Fasta

 

>lolC E. coli K12. Version NC_000913.3 GI:556503834
atgtaccaacctgtcgctctatttattggcctgcgttacatgcgtgggcgtgcagcggat
cgcttcggtcgtttcgtctcctggctttctaccatcggcattaccctcggggtgatggcg
ctggtcacagtattgtcagtgatgaacggctttgagcgcgagctgcaaaacaacatcctt
ggcctgatgccacaggcaattctctcttctgagcatggctctcttaacccgcagcaactc
ccagaaacggcagtcaaactggacggcgttaatcgcgtcgcacctattactaccggtgat
gtggtactgcaaagcgcgcgcagcgtggcggtcggggtgatgctcggtatcgacccggcg
caaaaagatccacttacaccgtatctggtcaatgtgaaacaaactgacctcgagccgggg
aaatataatgtcatcctcggcgaacaacttgcctcacagctaggcgttaatcgcggtgat
caaatccgcgtgatggtaccatctgccagccagttcacgccgatggggcgtattccaagc
cagcgcctgttcaatgtgattggcactttcgccgccaacagtgaagtcgatggctatgaa
atgctggtgaatattgaggatgcctcgcgtctgatgcgttatccggcaggcaatattacc
ggctggcgtttgtggctggatgagccgctgaaagtcgactcattaagtcagcaaaaactg
cctgaaggcagcaaatggcaggactggcgtgatcgtaaaggcgagttgttccaggccgta
cgcatggaaaaaaatatgatgggtttactgctgagcctgattgtcgccgttgcggcgttt
aacattattacctcactagggctgatggtaatggagaagcagggcgaagtagcgatcctg
caaacgcaaggcttaactccgcgacaaatcatgatggtctttatggtgcaaggggccagc
gccgggattatcggtgcgatcctcggagcggcgcttggcgccctgcttgccagccagtta
aataatctgatgccgataatcggcgtcctgcttgatggcgcggcgctgccggtggctatc
gaacctttacaggtcattgttattgcgctggtggcgatggctatcgcgctgctgtctacg
ctttacccttcatggcgcgctgccgccactcaacccgctgaggctttacgttatgaataa
              
                            

Download fasta file
RegulonDB