RegulonDB RegulonDB 10.8: Gene Sequence
lolD gene sequence


Size: 702        A: 161  T: 154  G: 208  C: 179

Fasta

 

>lolD E. coli K12. Version NC_000913.3 GI:556503834
atgaataagatcctgttgcaatgcgacaacctgtgcaaacgctatcaggaaggcagtgtg
caaaccgatgtgctgcacaatgtcagtttcagcgtcggcgaaggtgaaatgatggcgatc
gtcggtagctctggttccggtaaaagtaccttgctgcacctgctgggcgggctggatacg
ccaacctccggcgatgtgatttttaatggtcagccaatgagcaaactgtcgtcggcagcg
aaagctgaactgcgcaaccagaagctgggctttatttatcagtttcaccacctgctgccg
gattttaccgccctggaaaacgtggctatgccgctgctgattggcaagaaaaagcccgct
gaaatcaacagccgtgcacttgagatgttaaaagcggtggggctggatcatcgtgcgaat
caccgcccatctgaactttctggcggcgaacgccagcgtgtggcgattgcccgtgcgctg
gtgaataacccgcgcctggtactggcggatgaacctaccggtaacctcgatgcgcgtaac
gccgacagcatcttccagttgcttggggaattgaatcgcttgcagggcaccgccttcctg
gtggttactcacgacctgcaactggcgaaacgtatgagccgccagttagaaatgcgtgat
ggtcgtctgacggcggaactgagcctgatgggggcggagtaa
              
                            

Download fasta file
RegulonDB