RegulonDB RegulonDB 10.9: Gene Sequence
lolE gene sequence


Size: 1245        A: 269  T: 330  G: 365  C: 281

Fasta

 

>lolE E. coli K12. Version NC_000913.3 GI:556503834
atggcgatgcctttatcgttattaattggcctgcgttttagtcgcggacggcggcgcggc
ggcatggtgtcgctgatctccgttatttctaccattggcattgccctcggcgtggcggta
ttgatcgtcggcttaagcgcgatgaacggctttgaacgcgaactgaacaaccgtattctg
gcggtggtgccgcatggtgaaatcgaggcggtggatcagccgtggactaactggcaggaa
gcactggatcacgtgcaaaaagtgccgggtattgccgctgccgcgccgtatatcaatttc
accgggctggtggaaagtggcgcgaatcttcgcgcaatccaggtgaagggcgttaacccg
caacaggaacagcgtctgagcgcattaccctcgtttgtccagggcgatgcgtggcgcaat
tttaaagcgggcgaacagcaaattatcatcggcaaaggcgtggcggatgcgctgaaagtg
aagcagggggattgggtgtcgattatgatccccaactcgaatcccgagcataaactgatg
cagccaaaacgtgtgcgtttgcacgttgccggtattttgcagttgagtggtcaactcgat
cacagttttgccatgatcccgctggcggatgcccaacaatatcttgatatgggttccagc
gtgtcaggtattgcccttaaaatgacggatgttttcaacgccaataagctggtacgcgat
gcgggtgaagtgaccaacagctatgtttatattaaaagctggattggtacttacggctat
atgtatcgcgatatccaaatgatccgcgccattatgtatctggcgatggtactggtgatt
ggcgtggcctgtttcaacatcgtctccaccttagtgatggcggtgaaagacaagagtggc
gatatcgcagtattaagaacgctgggggcgaaagatggtttaattcgcgccatctttgtc
tggtatggattgctggcagggctgttcggcagcctgtgtggtgtgattatcggcgtagtg
gtttcactgcaacttaccccgattattgagtggattgaaaagttgatcggtcatcagttc
ctctccagcgatatctattttattgatttcctgccatcggaattgcactggctggacgtc
ttctacgtactggtcacagcattgttgctgagtcttttggcaagttggtatccggcgcgg
cgcgccagtaatattgaccctgcgcgagtccttagcggccagtaa
              
                            

Download fasta file
RegulonDB