RegulonDB RegulonDB 10.8: Gene Sequence
nagK gene sequence


Size: 912        A: 187  T: 244  G: 267  C: 214

Fasta

 

>nagK E. coli K12. Version NC_000913.3 GI:556503834
atgtattacgggtttgatattggtggaacaaaaattgcgcttggcgtgtttgatagcggt
cggcagttgcagtgggaaaagcgggtgccgacaccgcgtgacagctatgacgcattttta
gatgcagtgtgtgagctggtagctgaagctgaccaacgttttggctgtaaaggttctgtc
ggcatcggtattccgggaatgccggaaacagaagatggtacgctgtatgccgccaatgtc
cccgctgccagcggtaaaccgctgcgtgccgacctgagcgcacgtcttgatcgcgatgta
cgccttgataacgatgccaactgttttgccctttcagaagcctgggatgatgaatttact
caatatccactggtgatggggttgattctcggcaccggtgttggcggcgggctgattttc
aacggcaaaccgattaccggtaaaagctacattaccggcgagtttggccatatgcgtctg
ccggttgatgcgttaaccatgatggggttggatttcccgttacgccgctgcggctgtggt
cagcatggctgcattgaaaattatctgtctggtcgcggttttgcgtggctgtatcaacac
tattatcatcaaccgttgcaggctcccgaaattattgcgctttatgatcaaggcgatgag
caggcaagggcgcacgttgagcgttatctggatttattagcggtttgtctgggaaatatc
ctgaccatcgttgaccctgacctggtcgtcattggtggtggcttatcgaatttcccggca
atcacaacgcaactggcggacaggctgcctcgtcatctcttacctgtagctcgtgttccg
cgcattgaacgcgcgcgccacggtgatgcgggaggaatgcgtggtgcggccttcctacat
ctaaccgattaa
              
                            

Download fasta file
RegulonDB