RegulonDB RegulonDB 10.9: Gene Sequence
cobB gene sequence


Size: 840        A: 202  T: 203  G: 244  C: 191

Fasta

 

>cobB E. coli K12. Version NC_000913.3 GI:556503834
atgctgtcgcgtcggggtcatcggttaagtcgttttcgtaaaaataaacgccgcctgcgc
gagcgtttgcgtcagcgtatttttttcagagataaagtggtgccggaagcaatggaaaaa
ccaagagtactcgtactgacaggggcaggaatttctgcggaatcaggtattcgtaccttt
cgcgccgcagatggcctgtgggaagaacatcgggttgaagatgtggcaacgccggaaggt
ttcgatcgcgatcctgaactggtgcaagcgttttataacgcccgtcgtcgacagctgcag
cagccagaaattcagcctaacgccgcgcatcttgcgctggctaaactgcaagacgccctc
ggcgatcgctttttgctggtgacgcagaatatcgacaacctgcatgaacgcgcaggtaat
accaatgtgattcatatgcatggggaactgctgaaagtgcgttgttcacaaagtggtcag
gttctcgactggacaggagacgttaccccagaagataaatgccattgttgccagtttccg
gcacccttgcgcccgcacgtagtgtggtttggcgaaatgccactcggcatggatgaaatt
tatatggcgttgtcgatggccgatattttcattgccattggcacatccgggcatgtttat
ccggcggctgggtttgttcacgaagcgaaactgcatggcgcgcacaccgtggaactgaat
cttgaaccgagtcaggttggtaatgaatttgccgagaaatattacggcccggcaagccag
gtggtgcctgagtttgttgaaaagttgctgaagggattaaaagcgggaagcattgcctga
              
                            

Download fasta file
RegulonDB