RegulonDB RegulonDB 10.9: Gene Sequence
ycfZ gene sequence


Size: 789        A: 225  T: 228  G: 163  C: 173

Fasta

 

>ycfZ E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaattcattatactgctcagtttactgatactcctgcctctgacagcagccagc
aagccattaattccaataatgaagacactttttacggacgttaccggtactgtaccagat
gctgaagagatcgcgcataaagccgagctttttcgccaacaaacgggaattgcaccgttt
attgtggttttacccgacattaataatgaagccagtctcagacaaaatggtaaagcgatg
ctggcgcatgcgtcatcttcattgagtgatgtaaaaggaagtgttctgttactatttact
acccgcgaaccacggttaattatgatcaccaacggccaggttgaaagtggtctggacgat
aaacatctcggccttctgatagaaaatcacacgctggcttatttaaatgcagatctctgg
tatcagggaatcaataatgcattggctgttctacaagcacagatattaaaacaatcgacg
ccgccactaacgtattatccgcatccaggacaacagcatgaaaatgctccccccggcagc
accaacacattaggttttatcgcctgggctgcgacgtttatcttattttccaggatcttt
tactacacgactcgttttatttatgcgttaaaatttgcagtggcgatgactattgccaat
atgggttatcaggctttatgtttgtatatcgataatagctttgcgattaccagaatatcg
ccactctgggcagggctaattggtgtctgtacgtttattgccgcattgttattgacgagt
aaacgataa
              
                            

Download fasta file
RegulonDB