RegulonDB RegulonDB 10.9: Gene Sequence
ymfA gene sequence


Size: 462        A: 115  T: 146  G: 102  C: 99

Fasta

 

>ymfA E. coli K12. Version NC_000913.3 GI:556503834
atgagtcaggacagtaaagttttctttcgtatattcctcggtatcggtctggtactgatc
ctcatttctgttgttgtcttttataaccagttcacctatagcaaagacgcgattcatacc
gaaggcgtcattgttgataccgtctggcactccagtcattctcatcgcacgggtaaagat
ggttcgtggtatcccgtcgttgcctttcgaccgacgccagattacacgctaattttcaat
tcgagtatcggcagcgatttttatgaagacagcgaaggcgataaagttaatgtttattat
tctcccgggcatcctgaaaaggctgagataaataacccgtgggttaatttttttaaatgg
gggtttatcggcattatgggcgttatttttatcgccgtcggtttattaataagtatgccc
tcctctaaaaaatcacgcaggaaacggaagtcccgcccatga
              
                            

Download fasta file
RegulonDB