RegulonDB RegulonDB 10.9: Gene Sequence
nudJ gene sequence


Size: 462        A: 113  T: 117  G: 123  C: 109

Fasta

 

>nudJ E. coli K12. Version NC_000913.3 GI:556503834
atgtttaaaccgcacgttaccgttgcttgcgtggtgcacgcagaaggcaaatttttagtc
gttgaagagacgattaatggtaaagcgttatggaaccaacctgccgggcatctggaagcc
gatgaaaccttagtggaagccgccgcccgtgaactgtgggaagaaaccggcatcagcgcg
cagccgcaacactttattcgtatgcatcagtggattgcgccagataaaacgccgtttttg
cgtttcctctttgccattgagcttgagcaaatatgcccgacccagcctcatgacagcgat
atcgactgctgccgttgggtcagcgccgaagaaattttacaggcgtcaaatcttcgttcg
ccgctggtggcggaaagtattcgttgttatcaaagcgggcaacgttatccgctggagatg
attggcgattttaactggccttttacaaagggtgtcatctaa
              
                            

Download fasta file
RegulonDB