RegulonDB RegulonDB 10.9: Gene Sequence
rluE gene sequence


Size: 654        A: 173  T: 146  G: 163  C: 172

Fasta

 

>rluE E. coli K12. Version NC_000913.3 GI:556503834
atgcggcaattcataatctctgaaaataccatgcaaaaaacttcttttagaaatcaccag
gttaagcgattcagctcgcaacgttctaccaggcgtaaacctgaaaaccagcccacgcgt
gtgatcctgttcaataaaccctacgatgttcttccgcagttcaccgatgaagccggacgc
aaaacattaaaagaattcatcccggttcagggtgtttatgcagcaggtcgccttgaccgc
gatagcgaagggttgctggtgctgaccaataacggcgcgttgcaggcgcgtttaacccag
ccgggtaaacgcaccggaaaaatctattatgtgcaggtggaaggtattcccacacaagac
gcacttgaagccttgcgcaatggcgtaaccttaaatgatggccctaccctgcccgccggc
gcggagctggttgacgaacccgcgtggttatggccgcggaatccaccaattcgtgaacgc
aaaagtattcccaccagctggctgaagatcaccttatatgaaggacgtaatcgccaggtg
cgccgcatgaccgcccatgttggcttccccacgctgcgactgattcgctatgcgatgggt
gattactctttggataatcttgccaatggtgaatggcgagaagtgacagattaa
              
                            

Download fasta file
RegulonDB