RegulonDB RegulonDB 10.9: Gene Sequence
ymfD gene sequence


Size: 666        A: 235  T: 199  G: 125  C: 107

Fasta

 

>ymfD E. coli K12. Version NC_000913.3 GI:556503834
atggtacttgctttgaactataatatgcacggagttaatattcgctcagagaatgcagca
aaacctcatacgatgccctctagatatctttgcgagtatattagaagcattgagaaaaat
ggccacgcccttgattttggctgcggaaaacttagatattctgatgaattaatcagtaaa
tttgatgaagttacttttctagactcgaaaaggcaacttgaaagagagcaaattattaga
ggaattaaaactaaaattattgactatgtcccacgatattataaaaatgcaaatacagtt
gctttcgaggatgtcgacaaaataattgggggttacgatttcatcctttgctctaatgtt
ctctctgccgttccttgtcgggatacaatcgacaaaatagttcttagcatcaagagatta
ctaaaatcaggaggtgagactcttattgtaaatcaatataaaagctcatacttcaaaaaa
tacgaaacaggaagaaaacatctttacggatacatttacaaaaattcaaaaagtgtttct
tactatggattactcgatgaactcgcagtgcaagaaatatgttcttcacatggccttgaa
atattaaagtcgtggagtaaagcaggaagttcatatgtcactgttgggagttgtaatgca
atataa
              
                            

Download fasta file
RegulonDB