RegulonDB RegulonDB 10.9: Gene Sequence
ymfE gene sequence


Size: 705        A: 239  T: 248  G: 104  C: 114

Fasta

 

>ymfE E. coli K12. Version NC_000913.3 GI:556503834
gtgaataatatgttcgaaccccccaaaaattataatgaaatgttgcctaaacttcataaa
gcaactttcttaaatacgctaatatattgcatacttctagttatttacgaatacatccct
ttaataacattaccaaccaagtatgtcccacctattaaagatcatgagagctttattaat
tgggcactatcttttggtatattaccttgtgcttttgcgatttttgcatatttaattagc
ggtgcgttagacctacataacaatgcagccaaactacttcgggtgcgatatctttgggat
aagcatctaattataaaaccgttatcacggagagctggagtcaacagaaaattaaataaa
gatgaagctcacaatgtaatgagcaatctatattaccctgaagtaagaaaaattgaagac
aaacattatattgaactcttctggaataaagtatactatttttggatattttttgaattt
tcgataattgcattaatttccttcctaataatctttttttgcaaacaaatggatattttt
catgttgaaggttctttgctgtctttattcttttttgtaattttatcattctcagtgagt
ggtattatctttgctttgacagttaagcccagaactgaaagtcaagtcggaaaaatcccg
gacgataaaataaaagaatttttcactaaaaataacattaattga
              
                            

Download fasta file
RegulonDB