RegulonDB RegulonDB 10.9: Gene Sequence
ymfH gene sequence


Size: 312        A: 64  T: 79  G: 84  C: 85

Fasta

 

>ymfH E. coli K12. Version NC_000913.3 GI:556503834
gtggtgaatgcggctcagcgcacgcgggttaaggttgaggctgacaatcgaccttctgtg
gatacccacccgcctggtgtgcaaccttcgccaggcaccgggggcacccgacaccacaac
tttatgctgtgtgtagtcttggcggtaccagttttttccttagtcctttctggtaccgcc
ctttttacaaaacagagaagagtatccccggatgacgggttaataacccgacccatcctg
atagctgtggccacaggtgctcttctctgttttgtggagaaactaaccgaccgtgcaggg
tcgatatgctga
              
                            

Download fasta file
RegulonDB