RegulonDB RegulonDB 10.9: Gene Sequence
ymfT gene sequence


Size: 201        A: 66  T: 49  G: 47  C: 39

Fasta

 

>ymfT E. coli K12. Version NC_000913.3 GI:556503834
atgaaagcgtattgggactctttaaccaaagaacagcagggcgagttggccggaaaagtt
ggctcaacacctggctacttacggctggttttcaatggctataaaaaagccagttttgtg
ctggctaaaaaacttgagcaatacacatcaggtgcaattacgaaatctgacttaagaccg
gatatctatccgaaagattag
              
                            

Download fasta file
RegulonDB