RegulonDB RegulonDB 10.9: Gene Sequence
ymfL gene sequence


Size: 558        A: 142  T: 139  G: 156  C: 121

Fasta

 

>ymfL E. coli K12. Version NC_000913.3 GI:556503834
gtgggtaagcatcactggaaaatagaaaaacagcctgagtggtacgtgaaagctgtcaga
aaaactatcgcggcgttgccgagtggttacgctgaagcggctgactggctcgatgtaaca
gaaaacgctttattcaaccgccttcgtgcagatggcgatcagattttcccgctgggatgg
gcaatggttttacagcgtgctggtggcactcacttcattgctgatgctgtggcgcagtct
gcaaatggcgtctttgtgtctcttcctgacgtcgaggatgtggacaacgccgatattaac
cagcgtctgctggaagtcattgaacagatcggcagttattcaaaacagattcgttcagca
atcgaagacggtgtagtggaaccgcatgagaagacagcaattaacgacgagctgtatctc
tcaatttcgaagctgcaggagcatgcagcacttgtctacaaaattttttgcatttcagaa
agtaatgacgcccgcgagtgtgcagctccgggcgtcgtggcgtcgattgcttctggttgt
ggagaaactaacgcatga
              
                            

Download fasta file
RegulonDB