RegulonDB RegulonDB 10.9: Gene Sequence
ymfM gene sequence


Size: 339        A: 93  T: 77  G: 93  C: 76

Fasta

 

>ymfM E. coli K12. Version NC_000913.3 GI:556503834
atgaacagtttaacaacacactaccgtcgctcgcaactgattgcgcttcctgtaccgggt
ggaaaagcgaaggtggaatattgctatgcagtgaatgtaccaggtgacagggaaattgta
acccacagctttgcagagtgggctgtgggtgatttcaaccggcagaaggagacagtcctt
tgcgacaagttaaccgctggttcaaagatcactacggagtgcccgtcagagtcattcgtt
gggagccggaaacacaacgggttatctacctccgcgaaggttatgagcatgaatgcttca
gcccgctcgaacagtttcgtcgtaaattcagggaaatag
              
                            

Download fasta file
RegulonDB