RegulonDB RegulonDB 10.9: Gene Sequence
ymfN gene sequence


Size: 1368        A: 341  T: 284  G: 402  C: 341

Fasta

 

>ymfN E. coli K12. Version NC_000913.3 GI:556503834
atgagcactaaattaaccggctatgtatgggatggttgcgctgcatcaggcatgaagtta
tccagcgtggcaattatggcccgcctggctgatttcagtaatgacgaaggtgtgtgctgg
ccatcaattgaaaccattgcccgtcagattggcgcggggatgagtaccgtcagaacggct
atcgcacggctggaagcagaaggctggttaacgcgtaaggcgcgtcgccagggtgatggt
tcatcaccccactgtgccgtggtggatgaatatcacgagcacgccacagatgcgctttac
accacgatgcttaccgggatgggggcgcgacgccagccactgatgtgggccattaccacc
gccgggtacaacattgaggggccgtgctacgacaaacggcgggaagtcatcgagatgctc
aacggctcggtgccaaacgatgaactgttcgggatcatctataccgttgatgaaggtgac
gactggaccgacccgcaggtgctggaaaaagccaatccaaatattggcgtgtcggtttat
cgcgaatttttgttaagtcagcagcagcgtgcgaaaaataacgcccgtctggcaaacgtc
tttaaaacaaaacacctcaatatctgggcgtcggcgcgttcggcgtatttcaacctggtg
agctggcagagctgcgaggataaatcactgacccttgagcagttcgaggggcagccgtgc
attctggcctttgacctggcgcgtaagctggatatgaacagcatggcgcgactttatacc
cgcgagattgacggtaaaacgcattactacagtgtggccccgcgtttctgggtaccgtat
gacacggtgtacagcgtcgagaaaaatgaagatcgccggacagccgaacgctttcagaaa
tgggtggaaatgggcgttctgaccgttaccgatggtgcggaggtggattatcgctacatc
ctcgaagaggccaaagcggcgaacaaaatcagcccggtcagtgagtcacccatcgacccc
ttcggggcgaccgggctgtcacatgaccttgctgatgaagacctgaaccccgtcaccatc
attcagaactacaccaacatgtccgatccgatgaaagagctggaagcggcgattgaatcg
gggcgctttcatcatgacggcaatcccatcatgacctggtgtatcggcaacgtggtcggc
aaaaccattccgggtaacgatgatgtggtgaagcccgtcaaggagcaggcggaaaacaaa
atcgatggtgcagttgcgctgattatggcggttggcagagccatgctgtacgagaaagaa
gacacgctgtctgatcacattgagtcctacgggatccgctcgctttaa
              
                            

Download fasta file
RegulonDB