RegulonDB RegulonDB 10.9: Gene Sequence
beeE gene sequence


Size: 474        A: 102  T: 105  G: 149  C: 118

Fasta

 

>beeE E. coli K12. Version NC_000913.3 GI:556503834
gtgttcttttcgggattatttcaacgaaaaagtgacgcaccggtgaccacgccagcagag
ctggcggatgccatcgggctgtcgtatgacacctataccggaaagcagatcagcagtcag
cgggctatgcgactgacggcggttttttcctgcgtcagagtgctggcagagtcggtcggg
atgttgccctgcaatctgtatcacctgaacggcagcctgaagcagagagccaccggcgaa
cgtctgcataaactgatctccacgcatcccaatggctatatgacgccgcaggagttctgg
gagctggtggtcacctgtctgtgcctgaggggaaacttttacgcctacaaagtgaaagca
tttggcgaagtggctgaactgctgcccgtcgatcccggctgtgtggtatatgcgctggga
aggtgtcagcgatggcctgaaggtgaccgccgggagtgttattcagcgcgatga
              
                            

Download fasta file
RegulonDB