RegulonDB RegulonDB 10.9: Gene Sequence
jayE gene sequence


Size: 792        A: 167  T: 169  G: 259  C: 197

Fasta

 

>jayE E. coli K12. Version NC_000913.3 GI:556503834
gtgtggtatatgcgctgggaaggtgtcagcgatggcctgaaggtgaccgccgggagtgtt
attcagcgcgatgacctggtgcagtacacgacaactgacgatgcaaccagctccggtggt
gtcctgcgcgtgccgatcgcctgctcaagtgcaggtgcggtcggtaacgctgacgacggt
acggcattaatcctggtcacgccggtgaatggtctgccgtcttccggtgtggctgacacc
ctgacaggcggatttgatactgaagagctggaaacgtggcgcgcccgcgtcattgagcgg
tattactggacgccgcagggcggggctgacggggactatgtcgtctgggctaaagaagtg
cccggcattacccgcgcatggacataccgtcacttgatgggaacgggaactgtcggtgtg
atgattgccagcagtgacctgattaatcccattccggaagaatcaacggaaacggcggca
agacaacatatcgggccactggccccggtggcaggctctgatttgtatgtgttcaggccg
gtggcacatacggtggattttcatatccgcgtgacgccggacacaccagaaatacgggct
gccattaccgcggagttgcgttcgttcctgctgcgtgatggttatccgcagggagaactc
aaggtatcgcgtatcagtgaggcgatttccggtgcgaacggggaatacagccatcagttg
cttgcaccggtggacaatatctccattgcgaaaaacgaactggcggtactggggacgatt
tcatggacgtga
              
                            

Download fasta file
RegulonDB