RegulonDB RegulonDB 10.9: Gene Sequence
ymfQ gene sequence


Size: 585        A: 123  T: 127  G: 165  C: 170

Fasta

 

>ymfQ E. coli K12. Version NC_000913.3 GI:556503834
atggacgtgacaaacgatgattacatccgcctgttatcggcactgttgccgcccggtccg
gtgtggtcagccagcgatccggcgattgccggtgcggcaccgtcattaacccgtgttcat
cagcgtgcggatgccctgatgcgggagctggatccgcgcaccaccactgaactgataaac
cgctgggagcgtctgtgcggtctgccggatgaatgtattccggcgggaacgcagaccctt
cgccagcgtcagcaacggctggatgcgaaggttaacctggcgggcggcatcaacgaggat
ttttatcttgcacagcttgctgccctgggcagaccagatgccaccatcacgcgatacgac
aaaagcactttcacctgctcatcggcctgtactgacgcggtgaatgcgccggaatggcgg
tattactggcaggtcaacatgccagccaccaccaactccacctggatgacatgtggcgat
ccctgtgattccgcactgcgtatctggggtgacaccgttgtcgagtgtgtgcttaacaaa
ctctgcccgtcgcatacctacgtaatttttaaatatccggagtaa
              
                            

Download fasta file
RegulonDB