RegulonDB RegulonDB 10.9: Gene Sequence
tfaP gene sequence


Size: 414        A: 120  T: 120  G: 99  C: 75

Fasta

 

>tfaP E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatatactgttgcttaaataccgttggtttttttatggatggctgtggcgtcatt
ccgccagattctaaagaaataacggcagaacactggcagtcattattaaaatctcaagct
gaaggaggcgtgatcgatttttctgtttttcctccttctattaaagaggttatccgtact
catgatgatgaagtcgcagatgcgaactttcaaaagcagatgcttatctctgatgcaact
gattttatcaatagcagacagtggcagggtaaggctgcattgggaagacttaaagaagat
gagctgaaacaatataatttgtggctggattatctggaagcactggaactggttgataca
tccagtgcgccagatattgaatggcctacgcctccggcagttcaggccagatga
              
                            

Download fasta file
RegulonDB